View source for Quantification of miRNA by SYBR Green qPCR

[[ Category: miRNA ]]
[[ Category: Molecular Biology ]]
[[ Category: Transcription ]]
__NOTOC__

see [[ SOP - Chloroform ]] for safety information about working with Chloroform.

This is adapted from [http://dx.doi.org Yang ''et al'' 2010] 
==Materials==
* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]
* PolyA polymerase (NEB cat# M0276S)
* Phenol/Choroform mixture (1:1 ratio)
* 3M Sodium acetate pH 5.2
* Isopropanol
* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM
* dNTP Mixture (10 mM of each)
* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''
* Mature miRNA Primer

==Protocol==

===PolyA Tailing of RNA===
* Incubate at 37°C for 1 hour.  Components include
** 1 ug RNA
** 2 uL 10X polymerase reaction buffer
** 2 uL ATP (10 mM, comes with polymerase)
** 1 uL poly(A) polymerase
** ddH2O to a final volume of 20 uL
* Add 160 uL Water, 20 uL of 3 M sodium acetate, pH 5.2 and 200 uL of phenol/chloroform to tailed RNA, mix by tapping to form an emulsion
* Centrifuge for 1 min on max to separate layers
* Transfer the upper (aqueous) layer to a clean tube.   Add 200 uL chloroform and mix, spin and extract aqueous layer to a new tube twice to remove the excess phenol
* Add 140 uL of isopropanol, mix and incubate 5 minutes.  Centrifuge 15 minutes on max.  Aspirate supernatant being careful not to touch the pellet and air dry for 5-10 mins
* Reedissolved in 25 μL of water

===Reverse Transcriptase===
* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
* Add to a PCR tube (this is per reaction):
** 1 uL of Oligo dT Primer
** 1uL of dNTP
** 6uL of tailed RNA
** 5 uL Sterile water
* Heat at 65C for 5 minutes
* Briefly centrifugre then add (per reaction):
** 4 uL 5X First Strand Buffer
** 1 uL 0.1M DTT
** 1 uL RNAseOUT
** 1 uL of Superscript III RT
* Mix gently by pipetting and place in the PCR machine for the following program:
** Incubate at 50C for 60 min
** Inactivate by heating at 70C for 15 min

===qPCR===
* Try 50ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture). 
* The reverse primer was from the adapter sequence:  5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.   
* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
* Can use a protocol similar to the [[ QPCR ]] for mRNA quantification