Difference between revisions of "Quantification of miRNA by SYBR Green qPCR"

Revision as of 19:01, 10 January 2017

see SOP - Chloroform for safety information about working with Chloroform.

This is adapted from Yang et al 2010

Materials

• Purify total RNA, via the protocol: Purification of miRNA and mRNA with TRIzol
• PolyA polymerase (NEB cat# M0276S)
• Phenol/Choroform mixture (1:1 ratio)
• 3M Sodium acetate pH 5.2
• Isopropanol
• Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
• Oligo dT Adapter Primer 5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3, dissolved to 50 uM
• dNTP Mixture (10 mM of each)
• Reverse Adapter Sequence 5'GCGAGCACAGAATTAATACGACTCAC-3
• Mature miRNA Primer

Protocol

PolyA Tailing of RNA

• Incubate at 37°C for 1 hour. Components include
  • 1 ug RNA
  • 2 uL 10X polymerase reaction buffer
  • 2 uL ATP (10 mM, comes with polymerase)
  • 1 uL poly(A) polymerase
  • ddH2O to a final volume of 20 uL
• Add 160 uL Water, 20 uL of 3 M sodium acetate, pH 5.2 and 200 uL of phenol/chloroform to tailed RNA, mix by tapping to form an emulsion
• Centrifuge for 1 min on max to separate layers
• Transfer the upper (aqueous) layer to a clean tube. Add 200 uL chloroform and mix, spin and extract aqueous layer to a new tube twice to remove the excess phenol
• Add 140 uL of isopropanol, mix and incubate 5 minutes. Centrifuge 15 minutes on max. Aspirate supernatant being careful not to touch the pellet and air dry for 5-10 mins
• Reedissolved in 25 μL of water

Reverse Transcriptase

• Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
• Add to a PCR tube (this is per reaction):
  • 1 uL of Oligo dT Primer
  • 1uL of dNTP
  • 6uL of tailed RNA
  • 5 uL Sterile water
• Heat at 65C for 5 minutes
• Briefly centrifugre then add (per reaction):
  • 4 uL 5X First Strand Buffer
  • 1 uL 0.1M DTT
  • 1 uL RNAseOUT
  • 1 uL of Superscript III RT
• Mix gently by pipetting and place in the PCR machine for the following program:
  • Incubate at 50C for 60 min
  • Inactivate by heating at 70C for 15 min

qPCR

• Try 50ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture).
• The reverse primer was from the adapter sequence: 5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.
• The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
• Can use a protocol similar to the QPCR for mRNA quantification