Vinexin Genotyping
From Crucial role of vinexin for keratinocyte migration in vitro and epidermal wound healing in vivo.
Genotyping of mice
The genotypes of mutant mice were determined by nested PCR and confirmed by Southern blot analysis of genomic DNA from tail biopsies. Briefly, tail samples were incubated in lysis buffer (10 mM Tris (pH8.0), 150 mM NaCl, 10 mM EDTA, 0.1% SDS and 1 mg/ml proteinase K) at 55 °C for 4 h, followed by purification with phenol/chloroform and precipitation with isopropyl alcohol. The first PCR for nest PCR was performed using primers (F1 AAGCTGAGCGCAGAGCTGGACAAGGACCTG, R1 CCTGGAGTCTGCAGTTTCTAAGTCTCTCCC) under the following amplification conditions: 94 °C for 3 min, 25 cycles of 94 °C for 25 s, 65 °C for 25 s, and 72 °C for 150 s. A primer set (F2 TGCGAACTTTTCCGGAGGAGGTGGTGTCACTGG and R2 TCCCTACCTGTCTCTCTCACTCACCTCCAC) was used for the second PCR under the same amplification conditions to detect the wild-type allele (1.5 kb) and targeted allele (2.5 kb). In some experiments, another primer set (F2 and R3 TGGGTGGAAACATTCCAGGCCTGGGTGAGAGG) was used to detect the targeted allele only. For Southern blotting, SalI/EcoRI-digested genomic DNA was probed with a 0.4-kb fragment immediately upstream of the 5′ arm (Supplemental Fig. S1A, S1B).